Design Selection Tool : Dr. Wellington V. Nstp 's Laboratory Of Columbia University Medical Center

1033 Words Aug 12th, 2015 5 Pages
This research was supported by Dr. Wellington V. Cardoso. I would like to thank Dr. Munemasa Mori and Dr. Jining Lu from Cardoso’s laboratory of Columbia University Medical Center who provided insights and expertise that greatly assisted the research. I thank Dr. Munemasa Mori for assistance with virus co-transfection, ALI cell culture and comments that greatly improved the experimental protocol. I also thank Jun Li for assistance with DNA sub-cloning.
RESULTS
Selected sgRNA sequence for mfoxj1 and negative control
CRISPR Design® selection tool generated a series of scored sgRNA candidates for targeting mouse foxj1 gene. The sequence with the highest score was selected as the CRISPR sgRNA. Such sgRNA will lead endonuclease SpCas9 to target fox1 gene on chromosome 17.
Mfoxj1 sgRNA: 5’- GCATAGTCCACGTCGTCAGG - 3’ (score: 98)
To synthesize functional sgRNA for CRISPR-SpCas9 system, extra overhangs were required for insertion. All plasmids have the same overhangs after BsmBI digestion and the same oligos can be used for cloning other sgRNA (12).

Mouse foxj1 sgRNA with overhangs:
Oligo 1: 5’ CACCGGCATAGTCCACGTCGTCAGG 3’
Oligo 2: 3’ CCGTATCAGGTGCAGCAGTCCCAAA 5’

Scrambled sgRNA was designed by referring commercial negative-control plasmid pCas9-N® sgRNA. BLAST® has confirmed that such scrambled sgRNA would not lead SpCas9 to cleavage any genes in mouse.
Scrambled sgRNA with overhangs:
Oligo 1:…

Related Documents

Crayon Shin Chan: The Adult Empire Strike Back | Watch Now | Hunger Games